zgc:66427

Ensembl ID:
ENSDARG00000023303
ZFIN ID:
ZDB-GENE-040426-1913
Description:
hypothetical protein LOC406256 [Source:RefSeq peptide;Acc:NP_998148]
Human Orthologue:
ZNRF1
Human Description:
zinc and ring finger 1 [Source:HGNC Symbol;Acc:18452]
Mouse Orthologue:
Znrf1
Mouse Description:
zinc and ring finger 1 Gene [Source:MGI Symbol;Acc:MGI:2177308]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19822 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19822
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039386 Essential Splice Site 236 254 4 5
Genomic Location (Zv9):
Chromosome 2 (position 37610921)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37890053
GRCz11 2 37872510
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAATTTTCTGAAGAATGTATTGAATAATCGCTGATATTATTCTAAACA[G/A]TTGCATTGACACATGGAGCAAAGTGAAGCCGTGCTGCCCTGAGCATCCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link