zgc:114196

Ensembl ID:
ENSDARG00000023272
ZFIN ID:
ZDB-GENE-050913-99
Description:
Transcription factor AP-2-delta [Source:UniProtKB/Swiss-Prot;Acc:Q5RJ20]
Human Orthologue:
TFAP2D
Human Description:
transcription factor AP-2 delta (activating enhancer binding protein 2 delta) [Source:HGNC Symbol;Ac
Mouse Orthologue:
Tcfap2d
Mouse Description:
transcription factor AP-2, delta Gene [Source:MGI Symbol;Acc:MGI:2153466]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37160 Nonsense Mutation detected in F1 DNA During 2018
sa37159 Nonsense Available for shipment Available now
sa9817 Essential Splice Site Available for shipment Available now
sa23809 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37160
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031167 Nonsense 59 450 2 8
Genomic Location (Zv9):
Chromosome 20 (position 48410850)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 48254591
GRCz11 20 47731592
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTCTCCGCTTACATACCCAGCTACCGGAACCGAATTTGCCTCCCCGTA[T/A]TTTCCCACGAACCACCAGTACACGCCCTTACACCACCAGTCGTTCCACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37159
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031167 Nonsense 102 450 2 8
Genomic Location (Zv9):
Chromosome 20 (position 48410721)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 48254462
GRCz11 20 47731463
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCCGGACGCGTACTCGTTAAACTCTCTGCATCACTCGCAGCAGTATTA[C/A]CAGCAGCTCCATCACGGCGAACCGGCGGACTTCATCAACCTTCACAACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9817
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031167 Essential Splice Site 294 450 5 8
Genomic Location (Zv9):
Chromosome 20 (position 48403772)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 48247513
GRCz11 20 47724514
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCCGCAGGAAAGCAGCCAACGTCACACTCTTGACCTCTTTAGTGGAAG[G/A]TATGGACTCATTTGTGCGGCTCTGGTTTATATCATGWCTGTTTTCAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23809
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031167 Nonsense 430 450 8 8
Genomic Location (Zv9):
Chromosome 20 (position 48397796)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 48241537
GRCz11 20 47718538
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAAATAAGAGCACAGGAACGCCGGACACCAATCAGATCAACTCCAACT[C/A]GGACAAAACACTGCGCAAAACCGAGGCACCGACAAAAGACGGTAAAATCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast size: Genetic variants associated with breast size also influence breast cancer risk. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link