zgc:158327

Ensembl ID:
ENSDARG00000023237
ZFIN ID:
ZDB-GENE-070209-271
Description:
hypothetical protein LOC100009645 [Source:RefSeq peptide;Acc:NP_001076483]
Human Orthologue:
C14orf49
Human Description:
chromosome 14 open reading frame 49 [Source:HGNC Symbol;Acc:19861]
Mouse Orthologue:
4831426I19Rik
Mouse Description:
RIKEN cDNA 4831426I19 gene Gene [Source:MGI Symbol;Acc:MGI:2442408]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10496 Nonsense Available for shipment Available now
sa44870 Essential Splice Site Mutation detected in F1 DNA During 2018
sa13773 Essential Splice Site Available for shipment Available now
sa17025 Essential Splice Site Available for shipment Available now
sa6466 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10496
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033706 Nonsense 94 1038 2 17
Genomic Location (Zv9):
Chromosome 17 (position 15752354)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15903182
GRCz11 17 15911115
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATTAAAGAATCAGACTCATTSCAAACTCAAAGATYTGAAGGCKTTTTA[T/A]GATGACACGTTAACTTACATCATTCACTGTCACAGGTACAGACTGAGSAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44870
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033706 Essential Splice Site 106 1038 3 17
Genomic Location (Zv9):
Chromosome 17 (position 15752512)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15903340
GRCz11 17 15911273
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTATTTTCTCAGTTTATTAGTGTGATCTCTTTCATGCTCTCTGACA[G/T]TCGTATCGAGTGGGTTTGGCTGCACTGGAGTGAGTACTTAAAGGCTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13773
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033706 Essential Splice Site 541 1038 8 17
Genomic Location (Zv9):
Chromosome 17 (position 15772824)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15923652
GRCz11 17 15931585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGAGTTACTCCACAGCCAGCTCCAGCAGCGCAAGAACCGCCTGCAGG[T/C]ACACCAACAGCCTCCGCTCGCAATCTGACCGTAAATGCCTGCGATACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17025
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033706 Essential Splice Site 746 1038 12 17
Genomic Location (Zv9):
Chromosome 17 (position 15782323)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15933151
GRCz11 17 15941084
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCGAGAGTCCTGGATGTCCCTCCAMACGCTCAGTCTCAATCTGTACAG[G/C]TTAGGAGATGAAGTRATTTCTTTTAYAGAGGTTGTTGTTGSGATTCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6466
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033706 Essential Splice Site 971 1038 15 17
Genomic Location (Zv9):
Chromosome 17 (position 15787075)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15937903
GRCz11 17 15945836
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGATCCCTGAGCGCTAAAGAACTGAGGATAAGACAGAATACACTCAAG[G/A]TTGGTGGTGTTTGTTACAWTTTTTTTTWTTTTTTGCTTTCTTTTTTWTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link