si:dkey-30j22.11

Ensembl ID:
ENSDARG00000023228
ZFIN ID:
ZDB-GENE-041001-211
Description:
visinin-like 1 [Source:RefSeq peptide;Acc:NP_001007367]
Human Orthologue:
VSNL1
Human Description:
visinin-like 1 [Source:HGNC Symbol;Acc:12722]
Mouse Orthologue:
Vsnl1
Mouse Description:
visinin-like 1 Gene [Source:MGI Symbol;Acc:MGI:1349453]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23763 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23763
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031091 Nonsense 70 191 3 5
ENSDART00000135284 Nonsense 70 191 3 4
Genomic Location (Zv9):
Chromosome 20 (position 35448864)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35521377
GRCz11 20 35424256
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAGTTTTTCCCTTACGGTGATGCCTCAAAGTTTGCTCAGCATGCTTTC[A/T]GAACCTTTGACAAGAATGGCGATGGCACCATCGACTTCAGAGAGTTCATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link