plg

Ensembl ID:
ENSDARG00000023111
ZFIN ID:
ZDB-GENE-030131-1411
Description:
plasminogen [Source:RefSeq peptide;Acc:NP_958880]
Human Orthologues:
LPA, PLG
Human Descriptions:
lipoprotein, Lp(a) [Source:HGNC Symbol;Acc:6667]
plasminogen [Source:HGNC Symbol;Acc:9071]
Mouse Orthologue:
Plg
Mouse Description:
plasminogen Gene [Source:MGI Symbol;Acc:MGI:97620]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16064 Nonsense Available for shipment Available now
sa44949 Essential Splice Site Mutation detected in F1 DNA During 2018
sa37133 Nonsense Mutation detected in F1 DNA During 2018
sa16767 Nonsense Available for shipment Available now
sa37132 Essential Splice Site Mutation detected in F1 DNA During 2018
sa39304 Essential Splice Site Mutation detected in F1 DNA During 2018
sa39303 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa16064
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045816 Nonsense 179 818 6 20
ENSDART00000134689   None 148 None 5
Genomic Location (Zv9):
Chromosome 20 (position 42732784)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42803943
GRCz11 20 42701053
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAYGGAGATAAGGGGGGTCCCTGGTGCTACACCACAGATCCTGAGAAA[C/T]GATGGGAGCACTGCAATATCCAAGACTGCACAGGTRCATTCAGCAATTAW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44949
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045816 Essential Splice Site 230 818 7 20
ENSDART00000134689   None 148 None 5
Genomic Location (Zv9):
Chromosome 20 (position 42730597)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42801756
GRCz11 20 42698866
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACGCTGGGACTCTCAGCAACCCCAAAACCACGGTTACCTTCCTTCAGC[G/A]TAAGACCCTATTATTTAAAGCCCAATTGGCATATGGCCTATTTTGTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37133
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045816 Nonsense 330 818 10 20
ENSDART00000134689   None 148 None 5
Genomic Location (Zv9):
Chromosome 20 (position 42729301)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42800460
GRCz11 20 42697570
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAACAAACCTTAAACTGTATTTCTATCGCAGAGGCCTTGATGGGAACTA[C/A]TGCAGAAATCCTGATAATGAAAGAAGTCCATGGTGTTACACTACAGATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16767
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045816 Nonsense 473 818 12 20
ENSDART00000134689   None 148 None 5
Genomic Location (Zv9):
Chromosome 20 (position 42728654)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42799813
GRCz11 20 42696923
KASP Assay ID:
2261-4832.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RGCCCAACATACAGGAACCTCCYGCCAAACCAGCAGCTACAACTCCAACA[C/T]AGTCTACTCCAGCTCAGTCTACTCCAGATCAATCTGCTYCYTCAGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37132
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045816 Essential Splice Site 489 818 12 20
ENSDART00000134689   None 148 None 5
Genomic Location (Zv9):
Chromosome 20 (position 42728602)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42799761
GRCz11 20 42696871
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTACTCCAGCTCAGTCTACTCCAGATCAATCTGCTCCCTCAGAAAAAG[G/A]TGCATCCACCTAGAAGCTAAAAAATTATGTTAGATGTAAAAAGTACCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39304
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045816 Essential Splice Site 490 818 12 20
ENSDART00000134689   None 148 None 5
Genomic Location (Zv9):
Chromosome 20 (position 42728601)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42799760
GRCz11 20 42696870
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTACTCCAGCTCAGTCTACTCCAGATCAATCTGCTCCCTCAGAAAAAGG[T/A]GCATCCACCTAGAAGCTAAAAAATTATGTTAGATGTAAAAAGTACCATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39303
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045816 Nonsense 706 818 18 20
ENSDART00000134689   None 148 None 5
Genomic Location (Zv9):
Chromosome 20 (position 42723583)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42794742
GRCz11 20 42691852
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCACCTGTATGTCTACCAGAAAAAGACTACATTGTACCCAGCAATACT[G/T]AATGCTATGTAACAGGATGGGGGGAGACACAGGGTAAGTACTGTATAAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link