zbtb1

Ensembl ID:
ENSDARG00000023040
ZFIN ID:
ZDB-GENE-041001-126
Description:
zinc finger and BTB domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_999962]
Human Orthologue:
ZBTB1
Human Description:
zinc finger and BTB domain containing 1 [Source:HGNC Symbol;Acc:20259]
Mouse Orthologue:
Zbtb1
Mouse Description:
zinc finger and BTB domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2442326]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39285 Nonsense Mutation detected in F1 DNA During 2018
sa23723 Nonsense Available for shipment Available now
sa8944 Nonsense Mutation detected in F1 DNA During 2018
sa45700 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39285
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008306 Nonsense 227 677 2 2
ENSDART00000132222 Nonsense 227 677 1 1
Genomic Location (Zv9):
Chromosome 20 (position 27745862)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27817165
GRCz11 20 27716255
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTGAGAAAGAGAACATCAGGTCGAAGCTCTGCCATGAAAGAACGTCCT[C/T]GATTTGGTCGCACATACACGTGCGATGACTGTGGCTTTGTCTTCAGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23723
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008306 Nonsense 407 677 2 2
ENSDART00000132222 Nonsense 407 677 1 1
Genomic Location (Zv9):
Chromosome 20 (position 27746402)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27817705
GRCz11 20 27716795
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACAGAGTTGGACACCGATCTAAAGGTACATCGAATCAAAGAGGAAAAG[C/T]AAGATGGCACATGCATACCATGCGAGTTATGCGGAGCCCTGTTGACGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8944
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008306 Nonsense 474 677 2 2
ENSDART00000132222 Nonsense 474 677 1 1
Genomic Location (Zv9):
Chromosome 20 (position 27746603)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27817906
GRCz11 20 27716996
KASP Assay ID:
2261-4434.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCAGAGCGCTGTGGTGAACCCCAAGGTACCGAGATGGACTCCCCAGGT[G/T]AAGATTCGCTTCTACTTGAAGATGCCGAAGCTATGGAAGAAAACTTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45700
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008306 Nonsense 583 677 2 2
ENSDART00000132222 Nonsense 583 677 1 1
Genomic Location (Zv9):
Chromosome 20 (position 27746930)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27818233
GRCz11 20 27717323
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAAAAGCAGTTTACCTGTCAGACCTGCGGGAAACAGTTTCTGCGTGAA[C/T]GACAGCTTCGGCTGCACACTGACATGCACAAGGGAATGGCGCGATATGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link