zgc:112032

Ensembl ID:
ENSDARG00000022974
ZFIN ID:
ZDB-GENE-050522-274
Description:
Novel protein similar to H.sapiens WD repeat domain 13 (WDR13, zgc:112032) [Source:UniProtKB/TrEMBL;
Human Orthologue:
WDR13
Human Description:
WD repeat domain 13 [Source:HGNC Symbol;Acc:14352]
Mouse Orthologue:
Wdr13
Mouse Description:
WD repeat domain 13 Gene [Source:MGI Symbol;Acc:MGI:1914661]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41115 Nonsense Mutation detected in F1 DNA During 2018
sa845 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41115
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033294 Nonsense 40 482 3 10
ENSDART00000139545   None 100 None 5

The following transcripts of ENSDARG00000022974 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 7508920)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 6895723
GRCz11 8 6939271
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCCCAGTTCCGCACGCAGTACATCCGCCGGCGCAGCCAGCTGCTCCGC[G/T]AGAATGCCAAGTGTGGCTTTGAGCCGGGGCTGCGCAGGCAGTATCTGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa845
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033294 Nonsense 222 482 6 10
ENSDART00000139545   None 100 None 5

The following transcripts of ENSDARG00000022974 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 7503431)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 6890234
GRCz11 8 6933782
KASP Assay ID:
554-0748.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAAAGGTGACTCTGAAGGGCCACGCTGGGCCTGTGACCGACTTCGCTTG[G/A]TCGCTGAGCAATGATATCATTGTGTCCACTTCAAAAGATGGCACTCTGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link