zgc:66448

Ensembl ID:
ENSDARG00000022952
ZFIN ID:
ZDB-GENE-030131-5612
Description:
hypothetical protein LOC327401 [Source:RefSeq peptide;Acc:NP_956094]
Human Orthologue:
PRDM5
Human Description:
PR domain containing 5 [Source:HGNC Symbol;Acc:9349]
Mouse Orthologue:
Prdm5
Mouse Description:
PR domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1918029]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1785 Nonsense Confirmed mutation in F2 line During 2018

Mutation Details

Allele Name:
sa1785
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033211 Nonsense 1071 1356 2 2
Genomic Location (Zv9):
Chromosome 16 (position 27353714)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25199401
GRCz11 16 25114433
KASP Assay ID:
554-1778.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGCCAGAGCTGTTTAGTAACTCCTCAGATGGTAAAGGAACTGTTGATT[T/A]AGAAGCACCAACCATCGCCGACTCTAATAAACTGTCTCATGATTTACAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link