wnt7ba

Ensembl ID:
ENSDARG00000022858
ZFIN ID:
ZDB-GENE-041210-178
Description:
Protein Wnt [Source:UniProtKB/TrEMBL;Acc:Q5RGZ3]
Human Orthologue:
WNT7B
Human Description:
wingless-type MMTV integration site family, member 7B [Source:HGNC Symbol;Acc:12787]
Mouse Orthologue:
Wnt7b
Mouse Description:
wingless-related MMTV integration site 7B Gene [Source:MGI Symbol;Acc:MGI:98962]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31394 Nonsense Available for shipment Available now
sa26281 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31394
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003156 Nonsense 52 353 2 4
ENSDART00000142343 Nonsense 37 338 1 3
Genomic Location (Zv9):
Chromosome 4 (position 17775465)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18718305
GRCz11 4 18707281
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGGGCGCAAACATCATCTGCAACAAGATCCCCGGCCTGGCCCCCCGA[C/T]AGCGTGCCATCTGCCAGAGCCGCCCAGATGCCATCATCATCATTGGGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26281
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003156 Nonsense 262 353 4 4
ENSDART00000142343 Nonsense 247 338 3 3
Genomic Location (Zv9):
Chromosome 4 (position 17781885)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 18724725
GRCz11 4 18713701
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGAGCCACCCGTTTTCGACAGCCCTCCTTCCTACGTCTCAAGCAGTCT[C/T]GAGGGTACATCAAGCCCACAGACACAGACTTGGTGTTCTTAGAGCGCTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link