zgc:101640

Ensembl ID:
ENSDARG00000022807
ZFIN ID:
ZDB-GENE-041114-158
Description:
cytoplasmic phosphatidylinositol transfer protein 1 [Source:RefSeq peptide;Acc:NP_001007445]
Human Orthologue:
PITPNC1
Human Description:
phosphatidylinositol transfer protein, cytoplasmic 1 [Source:HGNC Symbol;Acc:21045]
Mouse Orthologue:
Pitpnc1
Mouse Description:
phosphatidylinositol transfer protein, cytoplasmic 1 Gene [Source:MGI Symbol;Acc:MGI:1919045]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42680 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42680
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038196 Essential Splice Site 208 287 7 9
ENSDART00000114944 Essential Splice Site 210 289 8 10
ENSDART00000141308   None 127 None 6
ENSDART00000146010   None 60 None 6
Genomic Location (Zv9):
Chromosome 16 (position 15198901)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13557360
GRCz11 16 13447480
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTTGGTGGGACACAGACAGGCGGTGGCATGGATTGACGAGTGGCATG[G/A]TAAATGAGACGTTCTGCAATGCTTCATTACCATAATTAACCACAAGCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link