zgc:63695

Ensembl ID:
ENSDARG00000022763
ZFIN ID:
ZDB-GENE-040426-1242
Description:
hippocalcin-like protein 1 [Source:RefSeq peptide;Acc:NP_957458]
Human Orthologue:
HPCAL1
Human Description:
hippocalcin-like 1 [Source:HGNC Symbol;Acc:5145]
Mouse Orthologue:
Hpcal1
Mouse Description:
hippocalcin-like 1 Gene [Source:MGI Symbol;Acc:MGI:1855689]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6126 Essential Splice Site Mutation detected in F1 DNA During 2018
sa23737 Nonsense Available for shipment Available now
sa43474 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6126
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028471   None 193 None 3
ENSDART00000137236   None 193 None 4
ENSDART00000147045 Essential Splice Site None 73 2 3
Genomic Location (Zv9):
Chromosome 20 (position 31331324)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31402537
GRCz11 20 31305416
KASP Assay ID:
554-3756.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTKATGTCTGTTTTTTTGTTTTGTTTTTGTTTTTTTTCATCTTKTTTTA[G/A]TAAGAACTGGCTGTACACATCTTGTCCTGGGCCTCCTCCCCTCTGTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23737
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028471 Nonsense 58 193 1 3
ENSDART00000137236 Nonsense 58 193 2 4
ENSDART00000147045 Nonsense 58 73 3 3
Genomic Location (Zv9):
Chromosome 20 (position 31264023)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31335236
GRCz11 20 31238115
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTGACGGTGGAGGAGTTCAAGAAGATCTATGCCAATTTCTTCCCCTA[C/A]GGTGATGCTTCCAAGTTTGCAGAGCACGTCTTTCGCACCTTCGACACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43474
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028471 Essential Splice Site 161 193 2 3
ENSDART00000137236 Essential Splice Site 161 193 3 4
ENSDART00000147045   None 73 None 3
Genomic Location (Zv9):
Chromosome 20 (position 31263230)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 31334443
GRCz11 20 31237322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGAAACGCACAGATAAGATATTCCGACAGATGGACACAGACAACGATG[G/A]TACGCCTCCTGAGAGCCGTCTCCCACTCACGCTTAAGATCCAGATAGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link