zgc:63658

Ensembl ID:
ENSDARG00000022744
ZFIN ID:
ZDB-GENE-040426-1216
Description:
GPI mannosyltransferase 3 [Source:UniProtKB/Swiss-Prot;Acc:Q7SXZ1]
Human Orthologue:
PIGB
Human Description:
phosphatidylinositol glycan anchor biosynthesis, class B [Source:HGNC Symbol;Acc:8959]
Mouse Orthologue:
Pigb
Mouse Description:
phosphatidylinositol glycan anchor biosynthesis, class B Gene [Source:MGI Symbol;Acc:MGI:1891825]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30387 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30387
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028357 Essential Splice Site 488 536 11 12
Genomic Location (Zv9):
Chromosome Zv9_scaffold3559 (position 36518)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 1330225
GRCz11 18 2205205
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGGTCCACACTGCCTTCACATTTAGTGCTGTTTGACTCCCTGCAGAAG[G/A]TATACACATCCCAAAACAAAGACATGATGACTTACTGACAGTGTTGGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link