EPHA2 (1 of 2)
- Ensembl ID:
- ENSDARG00000022727
- Description:
- EPH receptor A2 [Source:HGNC Symbol;Acc:3386]
- Human Orthologue:
- EPHA2
- Human Description:
- EPH receptor A2 [Source:HGNC Symbol;Acc:3386]
- Mouse Orthologue:
- Epha2
- Mouse Description:
- Eph receptor A2 Gene [Source:MGI Symbol;Acc:MGI:95278]
Alleles
There are 9 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa24328 |
Nonsense |
Available for shipment |
Available now |
sa6734 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa37702 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa12632 |
Nonsense |
Available for shipment |
Available now |
sa12623 |
Nonsense |
Available for shipment |
Available now |
sa16254 |
Nonsense |
Available for shipment |
Available now |
sa13554 |
Nonsense |
Available for shipment |
Available now |
sa11198 |
Nonsense |
Available for shipment |
Available now |
sa10796 |
Nonsense |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa24328
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000044918 |
Nonsense |
36 |
979 |
2 |
17 |
- Genomic Location (Zv9):
- Chromosome 23 (position 24681333)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
24467453 |
GRCz11 |
23 |
24393994 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGCAAATTTTGCGTTATTGTCACAGAGGTGTTATTGGATATGGTGGCAT[C/A]GGGAGCTGAGTTGGGTTGGTTGACATCGCCTGTTAAGGATGGGGTGAGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6734
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000044918 |
Nonsense |
42 |
979 |
2 |
17 |
- Genomic Location (Zv9):
- Chromosome 23 (position 24681314)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
24467434 |
GRCz11 |
23 |
24393975 |
- KASP Assay ID:
- 554-4960.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GTCACAGAGGTGTTATTGGATATGGTGGCATCGGGAGCTGAGTTGGGTTG[G/A]TTGACATCGCCTGTTAAGGATGGGGTGAGTTCACTTCTTATGTACGAGTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37702
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000044918 |
Essential Splice Site |
50 |
979 |
2 |
17 |
- Genomic Location (Zv9):
- Chromosome 23 (position 24681288)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
24467408 |
GRCz11 |
23 |
24393949 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGCATCGGGAGCTGAGTTGGGTTGGTTGACATCGCCTGTTAAGGATGGGG[T/C]GAGTTCACTTCTTATGTACGAGTACTGTTGCATGCATTTCTTTTCGATTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12632
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 23 (position 24680111)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
24466231 |
GRCz11 |
23 |
24392772 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CAGTGGGAGATAGGCCAGCAGGCTGTGAATGGCTCTCTGTTGTATAACTA[T/A]TATGTATGTAACGTGGAKAAAGGAGAACAAGACAACTGGCTCCGTACTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12623
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 23 (position 24680111)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
24466231 |
GRCz11 |
23 |
24392772 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CAGTGGGAGATAGGCCAGCAGGCTGTGAATGGCTCTCTGTTGTATAACTA[T/A]TATGTATGTAACGTGGAKAAAGGAGAACAAGACAACTGGCTCCGTACTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16254
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000044918 |
Nonsense |
67 |
979 |
3 |
17 |
- Genomic Location (Zv9):
- Chromosome 23 (position 24680108)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
24466228 |
GRCz11 |
23 |
24392769 |
- KASP Assay ID:
- 2261-7738.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TGGGAGATAGGCCAGCAGGCTGTGAATGGCTCTCTGTTGTATAACTAWTA[T/A]GTATGTAACGTGGAKAAAGGAGAACAAGACAACTGGCTCCGTACTACATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13554
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 23 (position 24679609)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
24465729 |
GRCz11 |
23 |
24392270 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CATTGCGGGAGGTGGCTGGAAGTTGTGTCAAAAATGCTATCAGTGAGGRC[C/T]AACCTCGCATTYATTGCACCACGGATGGGGAATGGGTCGTACCTATGAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11198
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 23 (position 24679609)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
24465729 |
GRCz11 |
23 |
24392270 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CATTGCGGGAGGTGGCTGGAAGTTGTGTCAAAAATGCTATCAGTGAGGRC[C/T]AACCTCGCATTYATTGCACCACGGATGGGGAATGGGTCGTACCTATGAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10796
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000044918 |
Nonsense |
671 |
979 |
11 |
17 |
- Genomic Location (Zv9):
- Chromosome 23 (position 24650380)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
24436690 |
GRCz11 |
23 |
24363231 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- ACACAGAGAAACAGAGGCAAGACTTCCTGAGTGAGGCCAGTATCATGGGA[C/T]AGTTCTCACACCAGAACATCATCCGGCTGGAAGGGGTTGTCACTAAATGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: