stat3

Ensembl ID:
ENSDARG00000022712
ZFIN ID:
ZDB-GENE-980526-68
Description:
signal transducer and activator of transcription 3 [Source:RefSeq peptide;Acc:NP_571554]
Human Orthologue:
STAT3
Human Description:
signal transducer and activator of transcription 3 (acute-phase response factor) [Source:HGNC Symbol
Mouse Orthologue:
Stat3
Mouse Description:
signal transducer and activator of transcription 3 Gene [Source:MGI Symbol;Acc:MGI:103038]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15744 Nonsense Available for shipment Available now
sa938 Essential Splice Site F2 line generated During 2018
sa10162 Essential Splice Site Available for shipment Available now
sa12185 Essential Splice Site Available for shipment Available now
sa16856 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15744
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022006 Nonsense 73 414 3 13
ENSDART00000080854 Nonsense 73 786 3 23
ENSDART00000104519 Nonsense 73 806 3 24
Genomic Location (Zv9):
Chromosome 3 (position 16690112)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16920331
GRCz11 3 17070131
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYTTCCACAACCTGCTGGGCGAGATCGATCAGCAGTACAGCCGCTTCCTG[C/T]AGGAGAACAACGWCCTGTACCAGCACAACCTGCGGCGCATCAAGCAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa938
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022006 Essential Splice Site 381 414 12 13
ENSDART00000080854 Essential Splice Site 381 786 12 23
ENSDART00000104519 Essential Splice Site 381 806 12 24
Genomic Location (Zv9):
Chromosome 3 (position 16701207)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16931426
GRCz11 3 17081226
KASP Assay ID:
554-0843.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCTATAAAAGTTGCTGCATTACTTTAGCCCTCTGCTTTTTTTTCTTCA[G/A]TTCACGCAAGTTCAACATCCTTGGCACTAACACTAAGGTGATGAACATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10162
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022006   None 414 None 13
ENSDART00000080854 Essential Splice Site 552 786 17 23
ENSDART00000104519 Essential Splice Site 552 806 17 24
Genomic Location (Zv9):
Chromosome 3 (position 16710533)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16940752
GRCz11 3 17090552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGTAAACTACWCCGGTTGCCAGATCACATGGGCTAAGTTCTGCAAAG[T/A]ATGTTTCTGCAATAATCACTTGTTCCTTGTTCTTTATAATTTTAGAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12185
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022006   None 414 None 13
ENSDART00000080854 Essential Splice Site 718 786 21 23
ENSDART00000104519 Essential Splice Site 718 806 21 24
ENSDART00000022006   None 414 None 13
ENSDART00000080854 Essential Splice Site 718 786 21 23
ENSDART00000104519 Essential Splice Site 718 806 21 24
Genomic Location (Zv9):
Chromosome 3 (position 16714800)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16945019
GRCz11 3 17094819
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCAGTAACTCAACCCTACCTGAAGACCAAGTTCATCTGTGTCACCCC[G/A]TAAGTAGCACTTATTTCTTCCTCTCWGAGTGTGTGTGTGTRTRTGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16856
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022006   None 414 None 13
ENSDART00000080854 Essential Splice Site 718 786 21 23
ENSDART00000104519 Essential Splice Site 718 806 21 24
ENSDART00000022006   None 414 None 13
ENSDART00000080854 Essential Splice Site 718 786 21 23
ENSDART00000104519 Essential Splice Site 718 806 21 24
Genomic Location (Zv9):
Chromosome 3 (position 16714800)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16945019
GRCz11 3 17094819
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCAGTAACTCAACCCTACCTGAAGACCAAGTTCATCTGTGTCACCCC[G/A]TAAGTAGCACTTATTTCTTCCTCTCWGAGTGTGTGTGTGTRTRTGTGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link