
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
stat3
- Ensembl ID:
- ENSDARG00000022712
- ZFIN ID:
- ZDB-GENE-980526-68
- Description:
- signal transducer and activator of transcription 3 [Source:RefSeq peptide;Acc:NP_571554]
- Human Orthologue:
- STAT3
- Human Description:
- signal transducer and activator of transcription 3 (acute-phase response factor) [Source:HGNC Symbol
- Mouse Orthologue:
- Stat3
- Mouse Description:
- signal transducer and activator of transcription 3 Gene [Source:MGI Symbol;Acc:MGI:103038]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15744 | Nonsense | Available for shipment | Available now |
sa938 | Essential Splice Site | F2 line generated | During 2018 |
sa10162 | Essential Splice Site | Available for shipment | Available now |
sa12185 | Essential Splice Site | Available for shipment | Available now |
sa16856 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa15744
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000022006 | Nonsense | 73 | 414 | 3 | 13 |
ENSDART00000080854 | Nonsense | 73 | 786 | 3 | 23 |
ENSDART00000104519 | Nonsense | 73 | 806 | 3 | 24 |
- Genomic Location (Zv9):
- Chromosome 3 (position 16690112)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 16920331 GRCz11 3 17070131 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TYTTCCACAACCTGCTGGGCGAGATCGATCAGCAGTACAGCCGCTTCCTG[C/T]AGGAGAACAACGWCCTGTACCAGCACAACCTGCGGCGCATCAAGCAGCAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa938
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000022006 | Essential Splice Site | 381 | 414 | 12 | 13 |
ENSDART00000080854 | Essential Splice Site | 381 | 786 | 12 | 23 |
ENSDART00000104519 | Essential Splice Site | 381 | 806 | 12 | 24 |
- Genomic Location (Zv9):
- Chromosome 3 (position 16701207)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 16931426 GRCz11 3 17081226 - KASP Assay ID:
- 554-0843.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TATCTATAAAAGTTGCTGCATTACTTTAGCCCTCTGCTTTTTTTTCTTCA[G/A]TTCACGCAAGTTCAACATCCTTGGCACTAACACTAAGGTGATGAACATGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10162
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000022006 | None | 414 | None | 13 | |
ENSDART00000080854 | Essential Splice Site | 552 | 786 | 17 | 23 |
ENSDART00000104519 | Essential Splice Site | 552 | 806 | 17 | 24 |
- Genomic Location (Zv9):
- Chromosome 3 (position 16710533)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 16940752 GRCz11 3 17090552 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTGTGTAAACTACWCCGGTTGCCAGATCACATGGGCTAAGTTCTGCAAAG[T/A]ATGTTTCTGCAATAATCACTTGTTCCTTGTTCTTTATAATTTTAGAGCAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12185
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000022006 | None | 414 | None | 13 | |
ENSDART00000080854 | Essential Splice Site | 718 | 786 | 21 | 23 |
ENSDART00000104519 | Essential Splice Site | 718 | 806 | 21 | 24 |
ENSDART00000022006 | None | 414 | None | 13 | |
ENSDART00000080854 | Essential Splice Site | 718 | 786 | 21 | 23 |
ENSDART00000104519 | Essential Splice Site | 718 | 806 | 21 | 24 |
- Genomic Location (Zv9):
- Chromosome 3 (position 16714800)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 16945019 GRCz11 3 17094819 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTTCAGTAACTCAACCCTACCTGAAGACCAAGTTCATCTGTGTCACCCC[G/A]TAAGTAGCACTTATTTCTTCCTCTCWGAGTGTGTGTGTGTRTRTGTGTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16856
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000022006 | None | 414 | None | 13 | |
ENSDART00000080854 | Essential Splice Site | 718 | 786 | 21 | 23 |
ENSDART00000104519 | Essential Splice Site | 718 | 806 | 21 | 24 |
ENSDART00000022006 | None | 414 | None | 13 | |
ENSDART00000080854 | Essential Splice Site | 718 | 786 | 21 | 23 |
ENSDART00000104519 | Essential Splice Site | 718 | 806 | 21 | 24 |
- Genomic Location (Zv9):
- Chromosome 3 (position 16714800)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 16945019 GRCz11 3 17094819 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTTCAGTAACTCAACCCTACCTGAAGACCAAGTTCATCTGTGTCACCCC[G/A]TAAGTAGCACTTATTTCTTCCTCTCWGAGTGTGTGTGTGTRTRTGTGTGT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Crohn's disease: A genome-wide association study identifies 2 susceptibility Loci for Crohn's disease in a Japanese population. (View Study)
- Crohn's disease: Genome-wide association defines more than 30 distinct susceptibility loci for Crohn's disease. (View Study)
- Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
- Multiple sclerosis: Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis. (View Study)
- Multiple sclerosis: Genome-wide association study in a high-risk isolate for multiple sclerosis reveals associated variants in STAT3 gene. (View Study)
- Multiple sclerosis: Genome-wide meta-analysis identifies novel multiple sclerosis susceptibility loci. (View Study)
- Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: