zgc:55733

Ensembl ID:
ENSDARG00000022579
ZFIN IDs:
ZDB-GENE-040426-791, ZDB-GENE-040426-791
Description:
hypothetical protein LOC393968 [Source:RefSeq peptide;Acc:NP_957287]
Human Orthologues:
HNRNPC, HNRNPCL1
Human Descriptions:
heterogeneous nuclear ribonucleoprotein C (C1/C2) [Source:HGNC Symbol;Acc:5035]
heterogeneous nuclear ribonucleoprotein C-like 1 [Source:HGNC Symbol;Acc:29295]
Mouse Orthologue:
Hnrnpc
Mouse Description:
heterogeneous nuclear ribonucleoprotein C Gene [Source:MGI Symbol;Acc:MGI:107795]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33998 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33998
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031255 Nonsense 112 279 4 8
ENSDART00000056538 Nonsense 122 289 5 9
Genomic Location (Zv9):
Chromosome 7 (position 4275619)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 3952541
GRCz11 7 4102045
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGATTCTTGGGTTTTCCTCCTCCCGCAGTTCTTCGTTTGATCTGGACTA[T/G]GACTTTCAGAGGGATTACTACGACAGGTGAGCGCTCCTAAAACATTCGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Genome-wide association of bipolar disorder suggests an enrichment of replicable associations in regions near genes. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link