
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:64141
- Ensembl ID:
- ENSDARG00000022560
- ZFIN ID:
- ZDB-GENE-040426-1379
- Description:
- chloride channel Kb [Source:RefSeq peptide;Acc:NP_956676]
- Human Orthologues:
- CLCNKA, CLCNKB
- Human Descriptions:
- chloride channel Ka [Source:HGNC Symbol;Acc:2026]
- chloride channel Kb [Source:HGNC Symbol;Acc:2027]
- Mouse Orthologues:
- Clcnka, Clcnkb
- Mouse Descriptions:
- chloride channel Ka Gene [Source:MGI Symbol;Acc:MGI:1329026]
- chloride channel Kb Gene [Source:MGI Symbol;Acc:MGI:1930643]
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa8872 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa18332 | Nonsense | Available for shipment | Available now |
sa37699 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa32442 | Essential Splice Site | Available for shipment | Available now |
sa37700 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa1792 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa8872
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000029974 | Essential Splice Site | 140 | 693 | 4 | 20 |
- Genomic Location (Zv9):
- Chromosome 23 (position 24562125)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 24348601 GRCz11 23 24275142 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTGTGCTCTGTCCACCAGCTTCGCCCACAGCGTCTGCCCATRCTCTGCAG[G/A]TTACACAGCACTWAGAAATTAGGGCAATMATTTTGTTTCATTTAATTTWA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18332
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000029974 | Nonsense | 193 | 693 | 6 | 20 |
- Genomic Location (Zv9):
- Chromosome 23 (position 24564288)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 24350764 GRCz11 23 24277305 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAATAWATTGACCTTAAACTTATTATCTYAATAGGGCCCATTTGTCCATT[T/G]WTCTATCATGGTTGGTGCATTTATGAAYCGTCTGCATGTCTCCTGTCGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37699
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000029974 | Essential Splice Site | 239 | 693 | 7 | 20 |
- Genomic Location (Zv9):
- Chromosome 23 (position 24564560)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 24351036 GRCz11 23 24277577 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGGCATCAGCGGTGGGAGTTGCGAGCTGTTTTGGGGCTCCAATAAGCGG[T/A]GAGTTCAAGTGTTTACATGACATAATTTTCAACCAAAAAAAGAAAAAAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32442
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000029974 | Essential Splice Site | 280 | 693 | 8 | 20 |
- Genomic Location (Zv9):
- Chromosome 23 (position 24567087)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 24353563 GRCz11 23 24280104 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGCGGCGCCATCACCTTCAGGCTGCTTTCTGTCTGTATTGGAGATCAAG[G/A]TAAGAGCTTTACACTTCCTACAGCGCCACCTAATGGATGCTTTTGCTGTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37700
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000029974 | Nonsense | 530 | 693 | 15 | 20 |
- Genomic Location (Zv9):
- Chromosome 23 (position 24573238)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 24359612 GRCz11 23 24286153 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGTTCCCGCTCTGGTGGCGACGCTCGTGTCCAATGCTGTGGCTCGGGCT[A/T]AACACAGGCCGTCTTTCTATGATGGCATATCGCTTATTAAACGGCTCCCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1792
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000029974 | Essential Splice Site | 682 | 693 | 20 | 20 |
- Genomic Location (Zv9):
- Chromosome 23 (position 24578539)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 24365115 GRCz11 23 24291656 - KASP Assay ID:
- 554-1784.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AACACAGAGCTCATACATTACAATTCATTATAAAATCTGATTTTTCTTCC[A/G]GATGAAAAAAATTATTGAAGAGATGGCAAAGGAGGTCTGATGAATAAAGG
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: