zgc:64141

Ensembl ID:
ENSDARG00000022560
ZFIN ID:
ZDB-GENE-040426-1379
Description:
chloride channel Kb [Source:RefSeq peptide;Acc:NP_956676]
Human Orthologues:
CLCNKA, CLCNKB
Human Descriptions:
chloride channel Ka [Source:HGNC Symbol;Acc:2026]
chloride channel Kb [Source:HGNC Symbol;Acc:2027]
Mouse Orthologues:
Clcnka, Clcnkb
Mouse Descriptions:
chloride channel Ka Gene [Source:MGI Symbol;Acc:MGI:1329026]
chloride channel Kb Gene [Source:MGI Symbol;Acc:MGI:1930643]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8872 Essential Splice Site Mutation detected in F1 DNA During 2018
sa18332 Nonsense Available for shipment Available now
sa37699 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32442 Essential Splice Site Available for shipment Available now
sa37700 Nonsense Mutation detected in F1 DNA During 2018
sa1792 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8872
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029974 Essential Splice Site 140 693 4 20
Genomic Location (Zv9):
Chromosome 23 (position 24562125)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24348601
GRCz11 23 24275142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGCTCTGTCCACCAGCTTCGCCCACAGCGTCTGCCCATRCTCTGCAG[G/A]TTACACAGCACTWAGAAATTAGGGCAATMATTTTGTTTCATTTAATTTWA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18332
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029974 Nonsense 193 693 6 20
Genomic Location (Zv9):
Chromosome 23 (position 24564288)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24350764
GRCz11 23 24277305
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATAWATTGACCTTAAACTTATTATCTYAATAGGGCCCATTTGTCCATT[T/G]WTCTATCATGGTTGGTGCATTTATGAAYCGTCTGCATGTCTCCTGTCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37699
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029974 Essential Splice Site 239 693 7 20
Genomic Location (Zv9):
Chromosome 23 (position 24564560)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24351036
GRCz11 23 24277577
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGCATCAGCGGTGGGAGTTGCGAGCTGTTTTGGGGCTCCAATAAGCGG[T/A]GAGTTCAAGTGTTTACATGACATAATTTTCAACCAAAAAAAGAAAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32442
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029974 Essential Splice Site 280 693 8 20
Genomic Location (Zv9):
Chromosome 23 (position 24567087)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24353563
GRCz11 23 24280104
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCGGCGCCATCACCTTCAGGCTGCTTTCTGTCTGTATTGGAGATCAAG[G/A]TAAGAGCTTTACACTTCCTACAGCGCCACCTAATGGATGCTTTTGCTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37700
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029974 Nonsense 530 693 15 20
Genomic Location (Zv9):
Chromosome 23 (position 24573238)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24359612
GRCz11 23 24286153
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTCCCGCTCTGGTGGCGACGCTCGTGTCCAATGCTGTGGCTCGGGCT[A/T]AACACAGGCCGTCTTTCTATGATGGCATATCGCTTATTAAACGGCTCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1792
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029974 Essential Splice Site 682 693 20 20
Genomic Location (Zv9):
Chromosome 23 (position 24578539)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24365115
GRCz11 23 24291656
KASP Assay ID:
554-1784.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACAGAGCTCATACATTACAATTCATTATAAAATCTGATTTTTCTTCC[A/G]GATGAAAAAAATTATTGAAGAGATGGCAAAGGAGGTCTGATGAATAAAGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link