rad21l1

Ensembl ID:
ENSDARG00000022493
ZFIN ID:
ZDB-GENE-061103-505
Description:
RAD21-like 1 [Source:RefSeq peptide;Acc:NP_001073519]
Human Orthologue:
RAD21L1
Human Description:
RAD21-like 1 (S. pombe) [Source:HGNC Symbol;Acc:16271]
Mouse Orthologue:
Gm14160
Mouse Description:
predicted gene 14160 Gene [Source:MGI Symbol;Acc:MGI:3652039]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45339 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45339
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079631 Essential Splice Site 227 546 7 14

The following transcripts of ENSDARG00000022493 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 51386997)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 49137384
GRCz11 8 49126153
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTAATGAATTGCCAGCTACACCTCCTCCAACTGCTGTCAACGCAGTAGG[T/C]AATGATACATTAGTTTTCTACATCTTCGCATCACATTGCATTTGACTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link