slc26a5

Ensembl ID:
ENSDARG00000022424
ZFIN ID:
ZDB-GENE-030131-1566
Description:
prestin [Source:RefSeq peptide;Acc:NP_958881]
Human Orthologue:
SLC26A5
Human Description:
solute carrier family 26, member 5 (prestin) [Source:HGNC Symbol;Acc:9359]
Mouse Orthologue:
Slc26a5
Mouse Description:
solute carrier family 26, member 5 Gene [Source:MGI Symbol;Acc:MGI:1933154]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11867 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11867
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038642 Essential Splice Site 675 739 17 19
Genomic Location (Zv9):
Chromosome 4 (position 14001469)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14937322
GRCz11 4 14936077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTCCTGTTAACTTTATTGACTCTGTAGGAGCCAAAACCATTAAATCAG[T/A]AAGTCGACAGCYTTTATTCTCAAACRAGACCGATATTTGCRACCTATCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link