zgc:113271

Ensembl ID:
ENSDARG00000022389
ZFIN ID:
ZDB-GENE-050522-525
Description:
goliath homolog [Source:RefSeq peptide;Acc:NP_001018301]
Human Orthologue:
RNF130
Human Description:
ring finger protein 130 [Source:HGNC Symbol;Acc:18280]
Mouse Orthologue:
Rnf130
Mouse Description:
ring finger protein 130 Gene [Source:MGI Symbol;Acc:MGI:1891717]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2766 Splice Site, Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa2766
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041886 Splice Site, Nonsense 200 337 4 7
Genomic Location (Zv9):
Chromosome 14 (position 37961721)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 36449192
GRCz11 14 36789506
KASP Assay ID:
554-3336.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTATTGAAGGTTATCAGCTAAATGATGTGGTCCGCATCCTCCCTTG[C/A]AAGTAAGTGCACATGTGTGTCTGCAAATGTTTTTTTTTTTTTATTTAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Coronary heart disease: Genome-wide association study of coronary heart disease and its risk factors in 8,090 African Americans: the NHLBI CARe Project. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link