znf536

Ensembl ID:
ENSDARG00000022251
ZFIN ID:
ZDB-GENE-030616-624
Description:
Novel zinc finger protein [Source:UniProtKB/TrEMBL;Acc:Q1LYK4]
Human Orthologue:
ZNF536
Human Description:
zinc finger protein 536 [Source:HGNC Symbol;Acc:29025]
Mouse Orthologue:
Zfp536
Mouse Description:
zinc finger protein 536 Gene [Source:MGI Symbol;Acc:MGI:1926102]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34159 Essential Splice Site Mutation detected in F1 DNA During 2018
sa34160 Nonsense Mutation detected in F1 DNA During 2018
sa18888 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34159
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034068   191 1389 1 4
ENSDART00000126085 Essential Splice Site 90 610 None 3
Genomic Location (Zv9):
Chromosome 7 (position 47982563)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 46100674
GRCz11 7 46373040
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGGTAATCTGAAAATCCACCTCCGCACCCATAAGCTGGGAAATCTTGG[T/A]AAGGGCCGTGGTCGTGTACGTGAGGAAAATAGGCTTCTTCATGAACTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34160
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034068 Nonsense 293 1389 1 4
ENSDART00000126085 Nonsense 152 610 3 3
Genomic Location (Zv9):
Chromosome 7 (position 47982869)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 46100980
GRCz11 7 46373346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGATGAGCAAGCCCTCAATCCAGCCCAAGGATACCGGTGCACTTTTTG[C/A]AAGGGTAAATTTAAGAAGCGCGAGGAGCTAGACCGCCACATTCGCATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18888
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034068 Nonsense 543 1389 1 4
ENSDART00000126085 Nonsense 402 610 3 3
Genomic Location (Zv9):
Chromosome 7 (position 47983619)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 46101730
GRCz11 7 46374096
KASP Assay ID:
554-6151.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTTGCAAGCTGCAGCTAAGGTAGCAGAAATGGACCCCCTAAACAGTTA[T/A]CAAGCCTGGCAAATCATGGCACGTGGAATGGCAATGGAGCGCTCCTTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link