v2ra1

Ensembl ID:
ENSDARG00000022229
ZFIN ID:
ZDB-GENE-050419-156
Description:
Novel protein similar to vertebrate pheremone receptor [Source:UniProtKB/TrEMBL;Acc:A3KQL3]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31618 Nonsense Available for shipment Available now
sa34237 Nonsense Mutation detected in F1 DNA During 2018
sa41080 Essential Splice Site Mutation detected in F1 DNA During 2018
sa21144 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31618
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059643 Nonsense 137 837 2 6
Genomic Location (Zv9):
Chromosome 7 (position 71862299)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 32474730
GRCz11 18 32445186
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCATTGATGAATGTTCAAGAATTTGCATCAAGAGGTAGCTGCAATGGA[C/T]AGTCTCCAGTACATGCTATCATAGGTGAAACAGAGTCTTCCAATACAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34237
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059643 Nonsense 356 837 3 6
Genomic Location (Zv9):
Chromosome 7 (position 71863036)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 32475467
GRCz11 18 32445923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGGAAACAGCTTTTCCATGCTCACAGACTTCACAGAAAGAAAATTCT[C/T]AATATAAATTAATTTGCAACATATATCGAGATCTTCTTGTACTGAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41080
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059643 Essential Splice Site 419 837 3 6
Genomic Location (Zv9):
Chromosome 7 (position 71863228)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 32475659
GRCz11 18 32446115
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAGAGAAAATGGAGCATGTGAAACAGACATGAAAATACAACCTCAGCAG[G/A]TAATAAACAAAAACAATGAATGAATGTTAGGAAGTTAGAGCGCAAGAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21144
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059643 Nonsense 711 837 6 6
Genomic Location (Zv9):
Chromosome 7 (position 71865991)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 32478422
GRCz11 18 32448878
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTTCTTATCTGTGTGCTTTGGCTAGCAGTATCTCCTCCATTGCCCTAC[A/T]AAAATACGAAATATTTCAAAGAAAAAATTATTCTTGAGTGCAGTCTGGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link