zgc:92254

Ensembl ID:
ENSDARG00000022183
ZFIN ID:
ZDB-GENE-040718-365
Description:
hypothetical protein LOC436894 [Source:RefSeq peptide;Acc:NP_001002621]
Human Orthologues:
GSTO1, GSTO2
Human Descriptions:
glutathione S-transferase omega 1 [Source:HGNC Symbol;Acc:13312]
glutathione S-transferase omega 2 [Source:HGNC Symbol;Acc:23064]
Mouse Orthologues:
Gsto1, Gsto2
Mouse Descriptions:
glutathione S-transferase omega 1 Gene [Source:MGI Symbol;Acc:MGI:1342273]
glutathione S-transferase omega 2 Gene [Source:MGI Symbol;Acc:MGI:1915464]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2705 Nonsense F2 line generated During 2018
sa1913 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2705
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038524 Nonsense 89 240 4 7
Genomic Location (Zv9):
Chromosome 13 (position 25608128)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25253788
GRCz11 13 25384238
KASP Assay ID:
554-3170.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCTGGAGACTCAGAGTGGTCAGGTGATCTACGARTCTCCAATCACCTG[T/A]GAGTACCTGGACGAGGTCTATCCTGAGAAGAAGCTGCTCCCGTYTGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1913
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038524 Nonsense 193 240 7 7
Genomic Location (Zv9):
Chromosome 13 (position 25612159)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25257819
GRCz11 13 25388269
KASP Assay ID:
554-1903.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATCATTAAATCCCAATCTGCAATGTGTCCTCATCATTTTCAGCTGCT[T/A]GGACGGCACACCTGAGCTGAAGAAGTGGACCGAGCGCATGATGGAGGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link