zgc:113651

Ensembl ID:
ENSDARG00000022139
ZFIN ID:
ZDB-GENE-050327-65
Description:
hypothetical protein LOC541527 [Source:RefSeq peptide;Acc:NP_001014362]
Human Orthologue:
C20orf123
Human Description:
chromosome 20 open reading frame 123 [Source:HGNC Symbol;Acc:16116]
Mouse Orthologue:
4833422F24Rik
Mouse Description:
RIKEN cDNA 4833422F24 gene Gene [Source:MGI Symbol;Acc:MGI:1921864]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15955 Nonsense Available for shipment Available now
sa21318 Nonsense Available for shipment Available now
sa21319 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15955
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033386 Nonsense 4 473 1 3
Genomic Location (Zv9):
Chromosome 8 (position 29544068)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28686794
GRCz11 8 28696026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCATCCTCTTCTCCAGGTCTTCTCATWRMAAACAGTAACAATGGCCTTA[C/T]AAARCCATCTCCGTCTGTTTTCTGTCAGGTATGTCAATATTTTTTAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21318
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033386 Nonsense 16 473 2 3
Genomic Location (Zv9):
Chromosome 8 (position 29548522)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28691248
GRCz11 8 28700480
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTGGTCTCTCTCTCTCTCTCTCCATGTTTTTCTATGTTAGATCATCAT[T/A]GAAACAAAGTTTGGAGACTCTCTGGTTGTGTTACTCTTCTCCGACCCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21319
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033386 Nonsense 69 473 2 3
Genomic Location (Zv9):
Chromosome 8 (position 29548680)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28691406
GRCz11 8 28700638
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCTCGCTGCTTTTCTATTGGCTCATTAATCTTTTGAGATATAACATC[C/T]AGACGGCACTGATCGCAGTTGGTATCTATGCCACAGCAGTGTTTATCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link