si:dkey-34e4.1

Ensembl ID:
ENSDARG00000022085
ZFIN ID:
ZDB-GENE-070705-456
Description:
Novel protein similar to vertebrate nitric oxide synthase 1 (Neuronal) adaptor protein (NOS1AP) [Sou
Human Orthologues:
NOS1AP, RP11-565P22.6
Human Description:
nitric oxide synthase 1 (neuronal) adaptor protein [Source:HGNC Symbol;Acc:16859]
Mouse Orthologue:
Nos1ap
Mouse Description:
nitric oxide synthase 1 (neuronal) adaptor protein Gene [Source:MGI Symbol;Acc:MGI:1917979]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40482 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40482
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048350 Nonsense 60 374 3 13
ENSDART00000137073 Nonsense 61 194 3 6
Genomic Location (Zv9):
Chromosome 5 (position 35192883)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32974832
GRCz11 5 33574985
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAAAAATGTCTCATCATGCATTTAAAGCACTTTTTTTTTCTTGCAGTA[T/G]GAGTTCAAGGCAAAGAGTGTGAAGAAGAAGAAAGTGGCTATCGTGGTCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link