zgc:171797

Ensembl ID:
ENSDARG00000022001
ZFIN ID:
ZDB-GENE-071004-97
Description:
hypothetical protein LOC560386 [Source:RefSeq peptide;Acc:NP_001103498]
Human Orthologue:
CNOT6
Human Description:
CCR4-NOT transcription complex, subunit 6 [Source:HGNC Symbol;Acc:14099]
Mouse Orthologue:
Cnot6
Mouse Description:
CCR4-NOT transcription complex, subunit 6 Gene [Source:MGI Symbol;Acc:MGI:2144529]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22556 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22556
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030357 Nonsense 231 558 7 12
Genomic Location (Zv9):
Chromosome 14 (position 52645276)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 49764473
GRCz11 14 48752230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAACTGGAGCTACAGGAAAAAGTCCATCATGCAGGAGATCCTCAACTG[C/A]AATGCAGACATCATCAGCTTACAGGTAAACGATTGTGTAAGCCTGGCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link