zgc:162162

Ensembl ID:
ENSDARG00000021974
ZFIN ID:
ZDB-GENE-070410-27
Description:
hypothetical protein LOC568747 [Source:RefSeq peptide;Acc:NP_001076329]
Human Orthologue:
C10orf78
Human Description:
chromosome 10 open reading frame 78 [Source:HGNC Symbol;Acc:29574]
Mouse Orthologue:
6330577E15Rik
Mouse Description:
RIKEN cDNA 6330577E15 gene Gene [Source:MGI Symbol;Acc:MGI:1915038]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35484 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35484
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031564   202 201 3 3
ENSDART00000125396 Essential Splice Site 201 201 None 4
Genomic Location (Zv9):
Chromosome 13 (position 24967045)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24612705
GRCz11 13 24743155
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATAAACTACTGCACTTTGATAGGACAGAGGAAGACTTCACAGACACG[T/C]GAATACATTTCAGCAATTTTTATTCACAGTTCAAACAGATTGCAGCGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link