zgc:101100

Ensembl ID:
ENSDARG00000021959
ZFIN ID:
ZDB-GENE-040801-82
Description:
hypothetical protein LOC445169 [Source:RefSeq peptide;Acc:NP_001003563]
Human Orthologue:
DMBX1
Human Description:
diencephalon/mesencephalon homeobox 1 [Source:HGNC Symbol;Acc:19026]
Mouse Orthologue:
Dmbx1
Mouse Description:
diencephalon/mesencephalon homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:2153518]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34375 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34375
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036630 Essential Splice Site None 266 2 4
Genomic Location (Zv9):
Chromosome 8 (position 21026598)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20456495
GRCz11 8 20488580
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGAGACTGATTGTTTTAGTATGCGCACACTCACACGTTGTATCCTCTC[A/T]GTCAGCAGAATGAATTCTGTGTATTTCTGTGGAGCAAGAAATGGCCAGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link