vax1

Ensembl ID:
ENSDARG00000021916
ZFIN ID:
ZDB-GENE-030904-9
Description:
Ventral anterior homeobox 1 [Source:UniProtKB/Swiss-Prot;Acc:Q801E0]
Human Orthologue:
VAX1
Human Description:
ventral anterior homeobox 1 [Source:HGNC Symbol;Acc:12660]
Mouse Orthologue:
Vax1
Mouse Description:
ventral anterior homeobox containing gene 1 Gene [Source:MGI Symbol;Acc:MGI:1277163]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42915 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42915
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031490 Nonsense 122 317 2 3
Genomic Location (Zv9):
Chromosome 17 (position 21269097)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21419246
GRCz11 17 21439082
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGACTGGAGATGGAGTTTCAGCGGTGTCAGTATGTTGTGGGACGGGAA[C/T]GAACTGAACTTGCCCGGCAACTTAACCTGTCTGAAACTCAGGTACACATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Orofacial clefts: Genome-wide association study identifies two susceptibility loci for nonsyndromic cleft lip with or without cleft palate. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link