upk1a

Ensembl ID:
ENSDARG00000021866
ZFIN ID:
ZDB-GENE-060421-2603
Description:
uroplakin-1a [Source:RefSeq peptide;Acc:NP_001035332]
Human Orthologues:
UPK1A, UPK1B
Human Descriptions:
uroplakin 1A [Source:HGNC Symbol;Acc:12577]
uroplakin 1B [Source:HGNC Symbol;Acc:12578]
Mouse Orthologues:
Upk1a, Upk1b
Mouse Descriptions:
uroplakin 1A Gene [Source:MGI Symbol;Acc:MGI:98911]
uroplakin 1B Gene [Source:MGI Symbol;Acc:MGI:98912]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42807 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42807
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036302 Essential Splice Site 111 250 4 8
Genomic Location (Zv9):
Chromosome 16 (position 47605739)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44803935
GRCz11 16 44770651
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTTTGAGTCCGCGTCTGCCATCACATCAGCAACCAACCGGGATTATG[T/C]GAGTTCAGCCAGCCTCTCAATGCTGTAAAATAAAGCAAATAATGTTATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link