zgc:56194

Ensembl ID:
ENSDARG00000021859
ZFIN ID:
ZDB-GENE-040426-934
Description:
Novel protein similar to vertebrate type 1 tumor necrosis factor receptor shedding aminopeptidase re
Human Orthologue:
ERAP1
Human Description:
endoplasmic reticulum aminopeptidase 1 [Source:HGNC Symbol;Acc:18173]
Mouse Orthologue:
Erap1
Mouse Description:
endoplasmic reticulum aminopeptidase 1 Gene [Source:MGI Symbol;Acc:MGI:1933403]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38471 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38471
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098527 Nonsense 485 710 9 14
ENSDART00000136806   None 343 None 6
ENSDART00000145187 Nonsense 504 960 10 19
ENSDART00000147224   None 252 None 5
Genomic Location (Zv9):
Chromosome 5 (position 27886247)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25641545
GRCz11 5 26241698
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTTGAATACCTGATGTAGGTTTGTGATTCCGATGGTCTGGATGAGGGC[C/T]GACTGAAGGGTGATGAGTCCTGTCGGCATTCAGCCTCAAACACTGGAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Alcohol dependence: Genome-wide association study of alcohol dependence. (View Study)
  • Ankylosing spondylitis: Genome-wide association study of ankylosing spondylitis identifies non-MHC susceptibility loci. (View Study)
  • Ankylosing spondylitis: Interaction between ERAP1 and HLA-B27 in ankylosing spondylitis implicates peptide handling in the mechanism for HLA-B27 in disease susceptibility. (View Study)
  • Behcet's disease: Genome-wide association analysis identifies new susceptibility loci for Behçet's disease and epistasis between HLA-B*51 and ERAP1. (View Study)
  • Hodgkin's lymphoma: Genome-wide association study of classical Hodgkin lymphoma and Epstein-Barr virus status-defined subgroups. (View Study)
  • Psoriasis: A genome-wide association study identifies new psoriasis susceptibility loci and an interaction between HLA-C and ERAP1. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link