zgc:92420

Ensembl ID:
ENSDARG00000021853
ZFIN ID:
ZDB-GENE-040801-200
Description:
hypothetical protein LOC445069 [Source:RefSeq peptide;Acc:NP_001003463]
Human Orthologue:
C1orf57
Human Description:
chromosome 1 open reading frame 57 [Source:HGNC Symbol;Acc:28204]
Mouse Orthologue:
2310079N02Rik
Mouse Description:
RIKEN cDNA 2310079N02 gene Gene [Source:MGI Symbol;Acc:MGI:1913816]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22383 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22383
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035018 Nonsense 181 185 5 6
ENSDART00000128507 Nonsense 197 201 5 6
ENSDART00000132895 Nonsense 181 185 5 5
Genomic Location (Zv9):
Chromosome 13 (position 49718639)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48457922
GRCz11 13 48748788
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACAAAGGAAAACAGAGACGTGATTTTTGACGACATTGTGTCTGCAGTA[C/T]GAGAGTGCCTGAAGTAAATGAGGAGCAGCATCATATATGCTAAAATATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link