wu:fj80h11

Ensembl ID:
ENSDARG00000021849
ZFIN ID:
ZDB-GENE-030131-9466
Description:
Wu:fj80h11 protein [Source:UniProtKB/TrEMBL;Acc:Q7SXB9]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22948 Nonsense Available for shipment Available now
sa22947 Nonsense Available for shipment Available now
sa42819 Essential Splice Site Mutation detected in F1 DNA During 2018
sa25031 Nonsense Mutation detected in F1 DNA During 2018
sa36255 Essential Splice Site Mutation detected in F1 DNA During 2018
sa16938 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22948
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032188 Nonsense 110 692 1 12
Genomic Location (Zv9):
Chromosome 16 (position 50592121)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47446196
GRCz11 16 47381282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTCAGGTGCACACTCTGGACGGAATGTTTGTTTACAGTCCTCGGAAT[G/T]AGTCAGGGCGCGCGCTCATCGTGCACGCGTTCACCAATAAATCCGCTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22947
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032188 Nonsense 169 692 1 12
Genomic Location (Zv9):
Chromosome 16 (position 50591944)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47446019
GRCz11 16 47381105
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGTCCATGGATGAGACTGCTGAACAGGACGCCCTCTGGATGAGGGAA[C/T]AGGTGTACAGAGCCGCTGCTCACAGGTACTGACAATGCAGACCTGAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42819
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032188 Essential Splice Site 282 692 3 12
Genomic Location (Zv9):
Chromosome 16 (position 50587431)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47441506
GRCz11 16 47376592
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGAGCTGTCGCTTGGGTATCAGAGGGAGGATGCTCTTTCTTTACTAAG[G/T]TGAATTACATGAGCTAAACAACGTGGATTTTGGTTCAATATTTAAGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25031
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032188 Nonsense 314 692 4 12
Genomic Location (Zv9):
Chromosome 16 (position 50587257)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47441332
GRCz11 16 47376418
KASP Assay ID:
554-7441.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTTGCCTGGAAATAACATTCAGGACATGAACTGCAAAGGGGATGAATG[T/A]TTTACTTCACTCCATATACCTGCATCGATGGTTCATTTCCAACCCAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36255
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032188 Essential Splice Site 480 692 8 12
Genomic Location (Zv9):
Chromosome 16 (position 50580822)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47434897
GRCz11 16 47369983
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGCGGGGCATTATTCAGTGCACTGAAAGTGTTTCTGACTGTGTTTGC[A/C]GAGGCACAGGCCATTGGCTGACAGACGTGTCTGCTTTGATTCCCCTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16938
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032188 Essential Splice Site 566 692 9 12
Genomic Location (Zv9):
Chromosome 16 (position 50577974)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47432049
GRCz11 16 47367135
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGCAGATACCATGAGATCACCTTTAGTATTCCAGCTGCAACAAAGAAGG[T/C]GATGGATCCTCGTATAATATTATTGTAATGTATACATACAATAAAACTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link