wu:fj63c11

Ensembl ID:
ENSDARG00000021846
ZFIN ID:
ZDB-GENE-030131-8263
Human Orthologue:
C17orf28
Human Description:
chromosome 17 open reading frame 28 [Source:HGNC Symbol;Acc:15736]
Mouse Orthologue:
C630004H02Rik
Mouse Description:
RIKEN cDNA C630004H02 gene Gene [Source:MGI Symbol;Acc:MGI:2445087]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20158 Essential Splice Site Available for shipment Available now
sa25265 Essential Splice Site Mutation detected in F1 DNA During 2018
sa17322 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20158
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036285 Essential Splice Site 127 257 3 6
Genomic Location (Zv9):
Chromosome 3 (position 57555908)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 56863505
GRCz11 3 56931021
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCACGTGACGCTGATTACACATATGACTCTCTTCAGGATGTCTTCTA[C/T]ACTGAGGCAGAGATGGAGAGGAGGAGACGTCTGTCCAGCTCCTCATCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25265
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036285 Essential Splice Site 184 257 5 6
Genomic Location (Zv9):
Chromosome 3 (position 57562551)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 56856953
GRCz11 3 56924479
KASP Assay ID:
554-7628.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGTAGTTTTTATCTTCTGCTGTGAAAGAGGTTTCTCTGCTGCTGTTTC[A/T]GAGGTCTGACCGATGAATCGGAGATCCTAAAGTTCCTCCAGCATGGCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17322
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036285 Essential Splice Site 184 257 5 6
Genomic Location (Zv9):
Chromosome 3 (position 57562552)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 56856952
GRCz11 3 56924478
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTAGTTTTTATCTTCTGCTGTGAAAGASGTTTCTCTGCTGCTGTTTCA[G/T]AGGTCTRACCGAYGAATCGGAGATCCTRAAGTTCCTCCAGCATGGCACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link