cherp

Ensembl ID:
ENSDARG00000021812
ZFIN ID:
ZDB-GENE-040407-1
Description:
calcium homeostasis endoplasmic reticulum protein [Source:RefSeq peptide;Acc:NP_956368]
Human Orthologue:
CHERP
Human Description:
calcium homeostasis endoplasmic reticulum protein [Source:HGNC Symbol;Acc:16930]
Mouse Orthologue:
Cherp
Mouse Description:
calcium homeostasis endoplasmic reticulum protein Gene [Source:MGI Symbol;Acc:MGI:106417]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29704 Essential Splice Site Mutation detected in F1 DNA During 2018
sa9494 Essential Splice Site Available for shipment Available now
sa45752 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa29704
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028634 Essential Splice Site 9 909 None 19
ENSDART00000110788 Essential Splice Site 9 532 None 18
ENSDART00000125265 Essential Splice Site 9 255 None 6
Genomic Location (Zv9):
Chromosome 22 (position 4630917)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4605331
GRCz11 22 4989706
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTAGCCTGTATTGCTGAGAAATATGGATATTTCCACGCCTCCAGAAGG[T/A]AAAACTGCGCCTGCGCGTGTGCTGCAGCGCGAACGCTAGAGAAGTCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028634 Essential Splice Site 78 909 3 19
ENSDART00000110788   None 532 None 18
ENSDART00000125265   None 255 None 6
Genomic Location (Zv9):
Chromosome 22 (position 4628653)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4603067
GRCz11 22 4987442
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTCCTTTATAGATTCTGGCACTCATGATGATGAATATAATATGGAAG[G/A]TATTTATTAGACCGATGTTTCAGAAATGTTTCATTTTGCCTGGTATTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45752
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028634 Nonsense 610 909 12 19
ENSDART00000110788   None 532 11 18
ENSDART00000125265   None 255 None 6
Genomic Location (Zv9):
Chromosome 22 (position 4614061)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4588475
GRCz11 22 4972850
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTGGGCCTCCACCCCACGGCTTCAATGGTCAGGCTCCGCACATAAGA[C/T]GACACAACCCACCACACGTCAGTCAGGATGACCCTAGTCTCGTGCCCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link