zfp36l2

Ensembl ID:
ENSDARG00000021806
ZFIN ID:
ZDB-GENE-030131-5873
Description:
butyrate response factor 2 [Source:RefSeq peptide;Acc:NP_996938]
Human Orthologue:
ZFP36L2
Human Description:
zinc finger protein 36, C3H type-like 2 [Source:HGNC Symbol;Acc:1108]
Mouse Orthologues:
Zfp36l2, Zfp36l3
Mouse Descriptions:
zinc finger protein 36, C3H type-like 2 Gene [Source:MGI Symbol;Acc:MGI:107945]
zinc finger protein 36, C3H type-like 3 Gene [Source:MGI Symbol;Acc:MGI:3525151]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15165 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15165
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035419   None 310 2 2
ENSDART00000142674 Nonsense 24 373 2 2
Genomic Location (Zv9):
Chromosome 12 (position 26906687)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 25287675
GRCz11 12 25379035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAATTTGTGTTTGCTTCAGGAAAAAGTCCCGAATTCGAATGCAATCTA[T/A]CTCCACAATATGCTGGAAAAGAGGAATGTTGGGGTCCCGCTTGCTGCTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link