aes

Ensembl ID:
ENSDARG00000021805
ZFIN ID:
ZDB-GENE-040426-1409
Description:
amino-terminal enhancer of split [Source:RefSeq peptide;Acc:NP_956717]
Human Orthologues:
AC010547.1, AES, TLE6
Human Descriptions:
amino-terminal enhancer of split [Source:HGNC Symbol;Acc:307]
transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila) [Source:HGNC Symbol;Acc:30788]
Mouse Orthologues:
Aes, Tle6
Mouse Descriptions:
amino-terminal enhancer of split Gene [Source:MGI Symbol;Acc:MGI:95806]
transducin-like enhancer of split 6, homolog of Drosophila E(spl) Gene [Source:MGI Symbol;Acc:MGI:21

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37507 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37507
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105564 Nonsense 80 197 5 7
ENSDART00000127222 Nonsense 80 197 6 8
Genomic Location (Zv9):
Chromosome 22 (position 22121286)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21774534
GRCz11 22 21799512
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTGTGTGTGTGTGTGTGTGCTTCTCCCTGCAGGCAGAGATCGTG[A/T]AGAGATTAAATGGGATCTGTGCTCAAGTCTTACCTTACCTGTCTCAAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link