cacna1ba

Ensembl ID:
ENSDARG00000021735
ZFIN ID:
ZDB-GENE-060531-44
Description:
voltage-dependent N-type calcium channel subunit alpha-1B [Source:RefSeq peptide;Acc:NP_001108020]
Mouse Orthologue:
Cacna1b
Mouse Description:
calcium channel, voltage-dependent, N type, alpha 1B subunit Gene [Source:MGI Symbol;Acc:MGI:88296]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1562 Nonsense F2 line generated During 2018
sa26487 Essential Splice Site Mutation detected in F1 DNA During 2018
sa31446 Nonsense Available for shipment Available now
sa20443 Essential Splice Site Available for shipment Available now
sa20442 Nonsense Available for shipment Available now
sa40452 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40451 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45208 Nonsense Mutation detected in F1 DNA During 2018
sa40450 Nonsense Mutation detected in F1 DNA During 2018
sa33622 Essential Splice Site Mutation detected in F1 DNA During 2018
sa33621 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1562
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047719 Nonsense 370 2312 8 48
ENSDART00000141154 Nonsense 370 2270 8 46
Genomic Location (Zv9):
Chromosome 5 (position 31016641)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28777998
GRCz11 5 29378151
KASP Assay ID:
554-1505.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAGGAGCGAGAGCGTGTGGAGAAAAGACAGGAGTTCTTAAAGCTGCGC[A/T]GACAACAGCAGATCGAAAGAGAGTTAACCGGATAYCTGGAGTGGATCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26487
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047719 Essential Splice Site 417 2312 9 48
ENSDART00000141154 Essential Splice Site 417 2270 9 46
Genomic Location (Zv9):
Chromosome 5 (position 31011027)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28772384
GRCz11 5 29372537
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGACAAGGATGATGTTGCCTGGTACAAGAGGAAATGCAACAACCCAGG[T/C]AACTCTTGAAAAATTACATTTATTAATTAAAAGTGCAGAATATCTTAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31446
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047719 Nonsense 1060 2312 21 48
ENSDART00000141154 Nonsense 1039 2270 20 46
Genomic Location (Zv9):
Chromosome 5 (position 30984156)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28745513
GRCz11 5 29345666
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATATGGGAGGAGATTCAATGGCTGTAAACCCCCATCAACCTTCAGTT[G/T]GAAGCCGGTGGTGTCTTGAGAAACCAGAAGATTCGGACAACAAACGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20443
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047719 Essential Splice Site 1186 2312 23 48
ENSDART00000141154 Essential Splice Site 1165 2270 22 46
Genomic Location (Zv9):
Chromosome 5 (position 30982235)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28743592
GRCz11 5 29343745
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCCTGGCTGCAGAAGACCCGGTCCAAGCCAATGCACCTCGGAACAATG[T/C]GAGCTGTTTTATCTGTGCTAAACGGGATGTCAGATTTTGACCTCATTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20442
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047719 Nonsense 1191 2312 24 48
ENSDART00000141154 Nonsense 1170 2270 23 46
Genomic Location (Zv9):
Chromosome 5 (position 30982114)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28743471
GRCz11 5 29343624
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTAACTGAAGACCATTTTATTTTTCGCTTCACAGGTCCTGAAGTATT[T/A]GGACTATGTCTTCACTGGTGTTTTCACATTCGAGATGGTCATTAAGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40452
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047719 Essential Splice Site 1207 2312 25 48
ENSDART00000141154 Essential Splice Site 1186 2270 24 46
Genomic Location (Zv9):
Chromosome 5 (position 30981455)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28742812
GRCz11 5 29342965
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGATTTTATCCTGATTAATCTTTCATATTTATGCTTTTCCTTTGACAA[G/T]ATGGTGGATTTAGGTTTAATTCTGCATCCTGGTTCCTACTTTCGAGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40451
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047719 Essential Splice Site 1274 2312 26 48
ENSDART00000141154 Essential Splice Site 1253 2270 25 46
Genomic Location (Zv9):
Chromosome 5 (position 30975673)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28737030
GRCz11 5 29337183
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGAGTCTTGCGACCTCTGAAGACCATCAAACGTCTACCAAAACTGAAG[G/T]TAAATATTCTGTTGCATTGCAATAGTTGAGCAGAAATTGGCAAAATATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45208
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047719 Nonsense 1471 2312 31 48
ENSDART00000141154 Nonsense 1450 2270 30 46
Genomic Location (Zv9):
Chromosome 5 (position 30965686)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28727043
GRCz11 5 29327196
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCCTCTTGCCTTCTTATGCTTGCAGTTCCATGGGGCGCCTGACTTTTA[T/G]GAGGCAATGCTTAAGTATCTCAACATTGTCTTCACTGTTCTCTTTTCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40450
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047719 Nonsense 1472 2312 31 48
ENSDART00000141154 Nonsense 1451 2270 30 46
Genomic Location (Zv9):
Chromosome 5 (position 30965685)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28727042
GRCz11 5 29327195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCTCTTGCCTTCTTATGCTTGCAGTTCCATGGGGCGCCTGACTTTTAT[G/T]AGGCAATGCTTAAGTATCTCAACATTGTCTTCACTGTTCTCTTTTCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33622
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047719 Essential Splice Site 1528 2312 32 48
ENSDART00000141154 Essential Splice Site 1507 2270 31 46
Genomic Location (Zv9):
Chromosome 5 (position 30964035)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28725392
GRCz11 5 29325545
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGACTGTGCTGGGCAGCATCACTGACATTTTAGTCACTGAGATTAACG[T/G]AAGTGAGCTCTGCATTTTTGCATAATTGAAGTAGTTTCAGAGCCTAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33621
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047719 Nonsense 1571 2312 34 48
ENSDART00000141154   None 2270 None 46
Genomic Location (Zv9):
Chromosome 5 (position 30958337)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28719694
GRCz11 5 29319847
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTACAAGAAGTTATAATATATTCATTTTTATTTCCAGGCACTGCCTTA[T/A]GTTTGCCTTCTAATCGCCATGCTGTTTTTCATCTACGCCATTATTGGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link