si:dkey-46k9.12

Ensembl ID:
ENSDARG00000021677
ZFIN ID:
ZDB-GENE-081104-417
Description:
LOC569187 protein [Source:UniProtKB/TrEMBL;Acc:Q6GML5]
Human Orthologue:
PHF11
Human Description:
PHD finger protein 11 [Source:HGNC Symbol;Acc:17024]
Mouse Orthologues:
AC114007.1, AC166169.1, D14Ertd668e, Gm6907, Phf11
Mouse Descriptions:
DNA segment, Chr 14, ERATO Doi 668, expressed Gene [Source:MGI Symbol;Acc:MGI:1277133]
PHD finger protein 11 family member [Source:RefSeq peptide;Acc:NP_001157799]
PHD finger protein 11 family member [Source:RefSeq peptide;Acc:NP_001157801]
PHD finger protein 11 Gene [Source:MGI Symbol;Acc:MGI:1918441]
predicted gene 6907 Gene [Source:MGI Symbol;Acc:MGI:3648476]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12508 Nonsense Available for shipment Available now
sa491 Essential Splice Site Available for shipment Available now
sa17745 Nonsense Available for shipment Available now
sa512 Nonsense Available for shipment Available now
sa41442 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa12508
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033902 Nonsense 64 531 2 18
ENSDART00000135399 Nonsense 60 83 2 11
ENSDART00000143493 Nonsense 64 306 2 15
ENSDART00000147481 Nonsense 64 207 2 18
Genomic Location (Zv9):
Chromosome 9 (position 30651796)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29807742
GRCz11 9 29618488
KASP Assay ID:
2260-1940.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCTACWGCAAGAACTCACCCACATATGATGACCTGTTTGGWTTTGATT[T/A]GGAAGAWGTAAAGAAAGAGCAGCGGAGAGGACAAAAACTTGTGCGTATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa491
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033902 Essential Splice Site 278 531 13 18
ENSDART00000135399   None 83 None 11
ENSDART00000143493 Essential Splice Site 264 306 13 15
ENSDART00000147481 Essential Splice Site None 207 13 18
Genomic Location (Zv9):
Chromosome 9 (position 30661884)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29817830
GRCz11 9 29628576
KASP Assay ID:
554-0344.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCATGTTCTTTGCAGGTCCTGTGAAAAGCTCAACCTATCAACCACAGG[T/A]AAAATGTGTTGACAAATTTGAAAACAAAGACACAAAGTATTAACTATGAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa17745
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033902 Nonsense 315 531 15 18
ENSDART00000135399   None 83 None 11
ENSDART00000143493 Nonsense 301 306 15 15
ENSDART00000147481   None 207 15 18
Genomic Location (Zv9):
Chromosome 9 (position 30663776)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29819722
GRCz11 9 29630468
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTCTCTCTCTCTTTCTCTCAGGAAGAGTCTCAGAGTGTGTTAACATA[T/A]GAAACGGACCCTGTGCCATGWATWGTTATTTTAGATYCGGGACCCTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa512
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033902 Nonsense 322 531 15 18
ENSDART00000135399   None 83 None 11
ENSDART00000143493   None 306 None 15
ENSDART00000147481   None 207 15 18
Genomic Location (Zv9):
Chromosome 9 (position 30663797)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29819743
GRCz11 9 29630489
KASP Assay ID:
554-0232.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGAAGAGTCTCAGAGTGTGTTAACATATGAAACGGACCCTGTGCCATG[T/A]ATTGTTATTTTAGATTCGGGACCCTCATTGGAATCAGGTGCATTCACATC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa41442
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033902 Nonsense 478 531 16 18
ENSDART00000135399   None 83 None 11
ENSDART00000143493   None 306 None 15
ENSDART00000147481   None 207 16 18
Genomic Location (Zv9):
Chromosome 9 (position 30664353)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29820299
GRCz11 9 29631045
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGCTCATGTCTCTGCTGCATAGCCTGGGACAAAGAGTGCAGTCGGGG[C/T]AAGCCAGTTACCAGGGTAAGAACAGCCTTCATTAAAGCACGTTTAGTGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiac hypertrophy: Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link