zgc:91811

Ensembl ID:
ENSDARG00000021589
ZFIN ID:
ZDB-GENE-040801-222
Description:
transmembrane protein 60 [Source:RefSeq peptide;Acc:NP_001003481]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15939 Missense, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15939
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034243 Missense 55 134 2 2
ENSDART00000143644 Nonsense 43 141 2 2
Genomic Location (Zv9):
Chromosome 25 (position 21948781)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21180657
GRCz11 25 21278311
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCCTTCCCATCTGGACCTTCGATCTGATCCTGCTYCTCATGCTCATTG[T/A]CAAAATGGCCGGTCGATGCAAACCAGGCTTCGACCCTCGCAATGGAGCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link