
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:123207
- Ensembl ID:
- ENSDARG00000021573
- ZFIN ID:
- ZDB-GENE-051113-248
- Description:
- hypothetical protein LOC641419 [Source:RefSeq peptide;Acc:NP_001032485]
- Human Orthologues:
- SLC16A1, SLC16A7
- Human Descriptions:
- solute carrier family 16, member 1 (monocarboxylic acid transporter 1) [Source:HGNC Symbol;Acc:10922
- solute carrier family 16, member 7 (monocarboxylic acid transporter 2) [Source:HGNC Symbol;Acc:10928
- Mouse Orthologues:
- Slc16a1, Slc16a7
- Mouse Descriptions:
- solute carrier family 16 (monocarboxylic acid transporters), member 1 Gene [Source:MGI Symbol;Acc:MG
- solute carrier family 16 (monocarboxylic acid transporters), member 7 Gene [Source:MGI Symbol;Acc:MG
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16042 | Nonsense | Available for shipment | Available now |
sa24262 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa16042
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000023099 | Nonsense | 175 | 465 | 6 | 7 |
- Genomic Location (Zv9):
- Chromosome 23 (position 9994864)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 9953005 GRCz11 23 9887975 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTCYACCCTGGCTCCAGTCAACCAATTTCTTTTTGACCAGTTTGGATGG[C/T]GAGGAAGCKTCTTCATYCTCGGAGGAGTGCTKTTCAACTGYTGYGTAGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24262
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000023099 | Nonsense | 363 | 465 | 6 | 7 |
- Genomic Location (Zv9):
- Chromosome 23 (position 9995428)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 9953569 GRCz11 23 9888539 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTTTGGCATGGTTTGCGCTCTTTTGTTTGAGGTACTCATGGATTTGGTT[G/T]GAGCTCAACGGTTCTCTAGTGCGGTTGGACTTGCTACGATTATAGAGTGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: