zgc:123207

Ensembl ID:
ENSDARG00000021573
ZFIN ID:
ZDB-GENE-051113-248
Description:
hypothetical protein LOC641419 [Source:RefSeq peptide;Acc:NP_001032485]
Human Orthologues:
SLC16A1, SLC16A7
Human Descriptions:
solute carrier family 16, member 1 (monocarboxylic acid transporter 1) [Source:HGNC Symbol;Acc:10922
solute carrier family 16, member 7 (monocarboxylic acid transporter 2) [Source:HGNC Symbol;Acc:10928
Mouse Orthologues:
Slc16a1, Slc16a7
Mouse Descriptions:
solute carrier family 16 (monocarboxylic acid transporters), member 1 Gene [Source:MGI Symbol;Acc:MG
solute carrier family 16 (monocarboxylic acid transporters), member 7 Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16042 Nonsense Available for shipment Available now
sa24262 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16042
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023099 Nonsense 175 465 6 7
Genomic Location (Zv9):
Chromosome 23 (position 9994864)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9953005
GRCz11 23 9887975
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCYACCCTGGCTCCAGTCAACCAATTTCTTTTTGACCAGTTTGGATGG[C/T]GAGGAAGCKTCTTCATYCTCGGAGGAGTGCTKTTCAACTGYTGYGTAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24262
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023099 Nonsense 363 465 6 7
Genomic Location (Zv9):
Chromosome 23 (position 9995428)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9953569
GRCz11 23 9888539
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTGGCATGGTTTGCGCTCTTTTGTTTGAGGTACTCATGGATTTGGTT[G/T]GAGCTCAACGGTTCTCTAGTGCGGTTGGACTTGCTACGATTATAGAGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link