
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:56235
- Ensembl ID:
- ENSDARG00000021564
- ZFIN ID:
- ZDB-GENE-040426-954
- Description:
- hypothetical protein LOC393186 [Source:RefSeq peptide;Acc:NP_956511]
- Human Orthologue:
- VDAC3
- Human Description:
- voltage-dependent anion channel 3 [Source:HGNC Symbol;Acc:12674]
- Mouse Orthologue:
- Vdac3
- Mouse Description:
- voltage-dependent anion channel 3 Gene [Source:MGI Symbol;Acc:MGI:106922]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15732 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa15732
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031121 | Nonsense | 7 | 281 | 2 | 9 |
The following transcripts of ENSDARG00000021564 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 10 (position 3310141)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 3302335 GRCz11 10 3302639 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTTCTCTTCTTGTGTATACATCAGTCATAATGGCTGTTCCTCCTGCGTA[T/A]TCAGACCTGGGAAAATCGGCCAAGGACATTTTCAGCAAGGGTTACGGTAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: