zgc:56235

Ensembl ID:
ENSDARG00000021564
ZFIN ID:
ZDB-GENE-040426-954
Description:
hypothetical protein LOC393186 [Source:RefSeq peptide;Acc:NP_956511]
Human Orthologue:
VDAC3
Human Description:
voltage-dependent anion channel 3 [Source:HGNC Symbol;Acc:12674]
Mouse Orthologue:
Vdac3
Mouse Description:
voltage-dependent anion channel 3 Gene [Source:MGI Symbol;Acc:MGI:106922]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15732 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15732
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031121 Nonsense 7 281 2 9

The following transcripts of ENSDARG00000021564 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 3310141)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3302335
GRCz11 10 3302639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCTCTTCTTGTGTATACATCAGTCATAATGGCTGTTCCTCCTGCGTA[T/A]TCAGACCTGGGAAAATCGGCCAAGGACATTTTCAGCAAGGGTTACGGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link