ubl3

Ensembl ID:
ENSDARG00000021556
ZFIN ID:
ZDB-GENE-040630-4
Description:
ubiquitin-like 3 [Source:RefSeq peptide;Acc:NP_998021]
Human Orthologue:
UBL3
Human Description:
ubiquitin-like 3 [Source:HGNC Symbol;Acc:12504]
Mouse Orthologue:
Ubl3
Mouse Description:
ubiquitin-like 3 Gene [Source:MGI Symbol;Acc:MGI:1344373]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22502 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22502
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029860 Essential Splice Site 75 117 3 5
ENSDART00000147597 Essential Splice Site 75 117 5 7
Genomic Location (Zv9):
Chromosome 14 (position 31732835)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30522892
GRCz11 14 30863206
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCTGATCTTCCAGGGTCGCTTCCTGCATGGCAATGTCACACTAGGAGG[T/G]GAGCACTAGACCTTGTAGTGAGCACTAGACCTTGTCCACATGTCTGTCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Biliary atresia: Genome-wide association study identifies a susceptibility locus for biliary atresia on 10q24.2. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link