
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rad23b
- Ensembl ID:
- ENSDARG00000021550
- ZFIN ID:
- ZDB-GENE-040426-1487
- Description:
- UV excision repair protein RAD23 homolog B [Source:RefSeq peptide;Acc:NP_956858]
- Human Orthologue:
- RAD23B
- Human Description:
- RAD23 homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:9813]
- Mouse Orthologue:
- Rad23b
- Mouse Description:
- RAD23b homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:105128]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23832 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa23832
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000124615 | Nonsense | 48 | 381 | 2 | 10 |
- Genomic Location (Zv9):
- Chromosome 21 (position 584649)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 442862 GRCz11 21 392413 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATGAAAAGGGAAAAGACGGGTTTCCAGTGGCGGGACAGAAGTTGATATA[C/A]GCAGGTGAGTCCTTTTTTCACCCGTTTCCACTGAGTGGTACAGTACATGG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Breast cancer: Novel breast cancer susceptibility locus at 9q31.2: results of a genome-wide association study. (View Study)
- Prostate cancer: Genome-wide association study in Chinese men identifies two new prostate cancer risk loci at 9q31.2 and 19q13.4. (View Study)
- Weight: Genome-wide association study of anthropometric traits and evidence of interactions with age and study year in Filipino women. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: