vrk2

Ensembl ID:
ENSDARG00000021547
ZFIN ID:
ZDB-GENE-040426-1046
Description:
serine/threonine-protein kinase VRK2 [Source:RefSeq peptide;Acc:NP_957464]
Human Orthologue:
VRK2
Human Description:
vaccinia related kinase 2 [Source:HGNC Symbol;Acc:12719]
Mouse Orthologue:
Vrk2
Mouse Description:
vaccinia related kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1917172]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35496 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35496
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036419 Essential Splice Site 266 574 8 13
ENSDART00000101441 Essential Splice Site 266 356 8 14

The following transcripts of ENSDARG00000021547 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 27011439)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 26657099
GRCz11 13 26787549
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTCCCTTCTCTTAAAAATCCAGCTGAGGTTCAGGAGGCCAAGGCCAA[G/A]TACGTTCCCCTTTTCACCACAGGTCTAGACCTTGAACTCTGTTGTGTACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link