zgc:73134

Ensembl ID:
ENSDARG00000021488
ZFIN ID:
ZDB-GENE-030131-4311
Description:
hypothetical protein LOC325586 [Source:RefSeq peptide;Acc:NP_956016]
Human Orthologue:
CYTH1
Human Description:
cytohesin 1 [Source:HGNC Symbol;Acc:9501]
Mouse Orthologue:
Cyth1
Mouse Description:
cytohesin 1 Gene [Source:MGI Symbol;Acc:MGI:1334257]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35345 Essential Splice Site Mutation detected in F1 DNA During 2018
sa16913 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35345
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032821 Essential Splice Site 186 399 7 13
Genomic Location (Zv9):
Chromosome 12 (position 35670849)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34073630
GRCz11 12 34174613
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGCTCAGCGTTACTGTCAGTGCAACCCTGGTGTCTTTCAGTCCACAGG[T/C]TTGTGTGTTTATATGATAATCTGACAGCATTGCAACAGTATTGCAAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16913
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032821 Nonsense 394 399 13 13
Genomic Location (Zv9):
Chromosome 12 (position 35688297)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34091078
GRCz11 12 34192061
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGCAGAGACCCATTCTACGAGATGCTGGCRGCGCGGAARAAGAAAGCCT[C/A]GTCTTTAAAGAGACAGTAGAAACACTTCAGCCCGARCATGGACCTGGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link