
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cdc14b
- Ensembl ID:
- ENSDARG00000021483
- ZFIN IDs:
- ZDB-GENE-040426-820, ZDB-GENE-040426-820
- Description:
- dual specificity protein phosphatase CDC14B [Source:RefSeq peptide;Acc:NP_956473]
- Human Orthologue:
- CDC14B
- Human Description:
- CDC14 cell division cycle 14 homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:1719]
- Mouse Orthologue:
- Cdc14b
- Mouse Description:
- CDC14 cell division cycle 14 homolog B (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2441808]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21171 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa21171
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000123896 | Nonsense | 393 | 465 | 12 | 15 |
ENSDART00000128870 | Nonsense | 332 | 404 | 12 | 15 |
- Genomic Location (Zv9):
- Chromosome 8 (position 1322362)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 1187950 GRCz11 8 1253693 - KASP Assay ID:
- 2260-0014.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTGAATGTGTTTTAATTGTTCAGCACACTGAAGAAGAAGAAGAGGACTG[T/A]GCTGGACTCACACAAGGTGACAAACTGCGAGCTCTGAAGAGCAAAAGGCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: