ireb2

Ensembl ID:
ENSDARG00000021466
ZFIN ID:
ZDB-GENE-051205-1
Description:
Iron regulatory protein 2 [Source:UniProtKB/TrEMBL;Acc:Q3YMK8]
Human Orthologue:
IREB2
Human Description:
iron-responsive element binding protein 2 [Source:HGNC Symbol;Acc:6115]
Mouse Orthologue:
Ireb2
Mouse Description:
iron responsive element binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1928268]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12679 Nonsense Available for shipment Available now
sa14739 Nonsense Available for shipment Available now
sa5705 Nonsense F2 line generated During 2018
sa3307 Nonsense F2 line generated During 2018
sa24600 Nonsense Available for shipment Available now
sa44228 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa12679
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046618 Nonsense 37 999 2 21
ENSDART00000135808 Nonsense 12 974 2 21
Genomic Location (Zv9):
Chromosome 25 (position 6607647)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 6127089
GRCz11 25 6254491
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTNCCTAGGAGTTTTTAATCAAAGCTTTTATTCCCTACAGAGCATCCATA[C/A]GGCCATTTGATTGACACTCTCCAGAGCGAACAATATSAAGAGCRGARATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14739
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046618 Nonsense 253 999 6 21
ENSDART00000135808 Nonsense 228 974 6 21
Genomic Location (Zv9):
Chromosome 25 (position 6600303)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 6119745
GRCz11 25 6247147
KASP Assay ID:
2261-9337.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGATGTCTGTCYGACGCACACACAGGCCTGAAACAATGGTCAGAAAC[C/T]AAGAGATGGAGCTAATCAGAAACAAAGAGAGGCTGCAGTTCTTYAAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5705
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046618 Nonsense 307 999 7 21
ENSDART00000135808 Nonsense 282 974 7 21
ENSDART00000046618 Nonsense 307 999 7 21
ENSDART00000135808 Nonsense 282 974 7 21
Genomic Location (Zv9):
Chromosome 25 (position 6599417)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 6118859
GRCz11 25 6246261
KASP Assay ID:
554-3079.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCTGGAGTACTTGTGTAAGGTGGTGCAAGAAGAGGAGGGCTTTATTTA[T/A]CCWGACAGTGTGGTGGGAACAGACTCTCACACAACTATGATYAATGGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3307
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046618 Nonsense 307 999 7 21
ENSDART00000135808 Nonsense 282 974 7 21
ENSDART00000046618 Nonsense 307 999 7 21
ENSDART00000135808 Nonsense 282 974 7 21
Genomic Location (Zv9):
Chromosome 25 (position 6599417)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 6118859
GRCz11 25 6246261
KASP Assay ID:
554-3079.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCTGGAGTACTTGTGTAAGGTGGTGCAAGAAGAGGAGGGCTTTATTTA[T/A]CCWGACAGTGTGGTGGGAACAGACTCTCACACAACTATGATYAATGGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24600
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046618 Nonsense 349 999 8 21
ENSDART00000135808 Nonsense 324 974 8 21
Genomic Location (Zv9):
Chromosome 25 (position 6598328)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 6117770
GRCz11 25 6245172
KASP Assay ID:
2261-9336.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTATTGAATCTGAGGCGGTGATGTTAGGTCAGCCGGTATCTTTGACTT[T/A]GCCGCAGGTGGTCGGCTGTAAACTTGTGGGGACCATTAATCCTCTTGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44228
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046618 Essential Splice Site 900 999 19 21
ENSDART00000135808 Essential Splice Site 875 974 19 21
Genomic Location (Zv9):
Chromosome 25 (position 6584000)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 6103442
GRCz11 25 6230844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGCTCAGGCAGCTCACGGGACTGGGCTGCCAAAGGACCTTATTTACTG[G/A]TAGGAGACGTATAAACCTTGAAATCAAAAAGTATTGAGCTGCGATTCACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link