wdr69

Ensembl ID:
ENSDARG00000021462
ZFIN ID:
ZDB-GENE-050419-255
Description:
WD repeat-containing protein 69 [Source:UniProtKB/Swiss-Prot;Acc:Q1LV15]
Human Orthologue:
WDR69
Human Description:
WD repeat domain 69 [Source:HGNC Symbol;Acc:26383]
Mouse Orthologue:
Wdr69
Mouse Description:
WD repeat domain 69 Gene [Source:MGI Symbol;Acc:MGI:1923089]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45651 Essential Splice Site Mutation detected in F1 DNA During 2018
sa2977 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa45651
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024202 Essential Splice Site 106 415 4 13
ENSDART00000142790 Essential Splice Site 106 418 4 12
Genomic Location (Zv9):
Chromosome 18 (position 44795101)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46388630
GRCz11 18 46386648
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACATCTTGCCCCTGACGAATGTAGCCTTCAATAAATCAGGATCTTGG[T/C]GAGTTTATCAGCTGCGCTCACATGCCTCCCTCTCTCCGATCCTCCCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2977
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024202 Nonsense 233 415 8 13
ENSDART00000142790 Nonsense 233 418 8 12
Genomic Location (Zv9):
Chromosome 18 (position 44796609)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 46390138
GRCz11 18 46388156
KASP Assay ID:
554-3227.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGTCACTTCGCTGAGATCATCTCTCTGTGCTTTAACACAACGGGTGAT[C/T]GATTGGTCACGGGGTCATTTGACCACACTGCCATTTTATGGGATGTTCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Tonometry: Framingham Heart Study 100K Project: genome-wide associations for blood pressure and arterial stiffness. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link