zgc:110319

Ensembl ID:
ENSDARG00000021404
ZFIN ID:
ZDB-GENE-050417-345
Description:
hypothetical protein LOC796111 [Source:RefSeq peptide;Acc:NP_001018093]
Human Orthologue:
NFU1
Human Description:
NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:16287]
Mouse Orthologue:
Nfu1
Mouse Description:
NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1913290]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35454 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35454
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023806 Essential Splice Site 94 256 None 8
ENSDART00000133931 Essential Splice Site 72 234 None 8

The following transcripts of ENSDARG00000021404 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 18405801)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18225836
GRCz11 13 18356828
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACATTTCCTCATTGTGTATTAAATTCTTATTAAGTTCTTTCCATCCAC[A/C]GGGATCTTTTCCAAATCAGTGGAATAAAAAGTGTCTTTTACGGACCAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link