zgc:56429

Ensembl ID:
ENSDARG00000021383
ZFIN ID:
ZDB-GENE-040426-1025
Description:
hypothetical protein LOC393247 [Source:RefSeq peptide;Acc:NP_956571]
Human Orthologues:
FOLH1, NAALAD2
Human Descriptions:
folate hydrolase (prostate-specific membrane antigen) 1 [Source:HGNC Symbol;Acc:3788]
N-acetylated alpha-linked acidic dipeptidase 2 [Source:HGNC Symbol;Acc:14526]
Mouse Orthologues:
Folh1, Naalad2
Mouse Descriptions:
folate hydrolase Gene [Source:MGI Symbol;Acc:MGI:1858193]
N-acetylated alpha-linked acidic dipeptidase 2 Gene [Source:MGI Symbol;Acc:MGI:1919810]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6399 Nonsense Mutation detected in F1 DNA During 2018
sa42624 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6399
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010881 Nonsense 251 745 6 19
Genomic Location (Zv9):
Chromosome 15 (position 42721056)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43900378
GRCz11 15 43923821
KASP Assay ID:
554-5423.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAATCTGCCCGGTGGAGGCGCTCARAGGGGGAACGTGCTGAATCTGAAT[G/T]GAGCCGGAGACCCTCTYACACCAGGATACCCTGCTAAAGNNNNNNNNNNNNNNNNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42624
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010881 Essential Splice Site 327 745 9 19
Genomic Location (Zv9):
Chromosome 15 (position 42726078)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43905400
GRCz11 15 43928843
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCACTGTGTTTGTGTATTATTAATATTAATTTTTTCCCTTCATTTTA[G/A]AAAAGTGCGTATGAACATCCACACTAACAATCAGGTGACCCGTATCTACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Triglycerides: Loci influencing lipid levels and coronary heart disease risk in 16 European population cohorts. (View Study)
  • White blood cell types: Identification of nine novel loci associated with white blood cell subtypes in a Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link